ID: 958447272

View in Genome Browser
Species Human (GRCh38)
Location 3:94231286-94231308
Sequence CATTAAGCATAATTTGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958447272_958447274 17 Left 958447272 3:94231286-94231308 CCTAACTCAAATTATGCTTAATG No data
Right 958447274 3:94231326-94231348 CAAACATCAAATTTTCACAATGG No data
958447272_958447276 30 Left 958447272 3:94231286-94231308 CCTAACTCAAATTATGCTTAATG No data
Right 958447276 3:94231339-94231361 TTCACAATGGGTCTTGTCAAAGG No data
958447272_958447275 18 Left 958447272 3:94231286-94231308 CCTAACTCAAATTATGCTTAATG No data
Right 958447275 3:94231327-94231349 AAACATCAAATTTTCACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958447272 Original CRISPR CATTAAGCATAATTTGAGTT AGG (reversed) Intergenic
No off target data available for this crispr