ID: 958449768

View in Genome Browser
Species Human (GRCh38)
Location 3:94259149-94259171
Sequence AATGAGGGAGGGGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958449768_958449778 18 Left 958449768 3:94259149-94259171 CCACCTGGGGCCCCTCCCTCATT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449768_958449777 17 Left 958449768 3:94259149-94259171 CCACCTGGGGCCCCTCCCTCATT No data
Right 958449777 3:94259189-94259211 AGGACTCCACACTTTACAGGTGG No data
958449768_958449775 -3 Left 958449768 3:94259149-94259171 CCACCTGGGGCCCCTCCCTCATT No data
Right 958449775 3:94259169-94259191 ATTGTTGCTAACTTATCATCAGG No data
958449768_958449776 14 Left 958449768 3:94259149-94259171 CCACCTGGGGCCCCTCCCTCATT No data
Right 958449776 3:94259186-94259208 ATCAGGACTCCACACTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958449768 Original CRISPR AATGAGGGAGGGGCCCCAGG TGG (reversed) Intergenic
No off target data available for this crispr