ID: 958449775

View in Genome Browser
Species Human (GRCh38)
Location 3:94259169-94259191
Sequence ATTGTTGCTAACTTATCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958449766_958449775 -1 Left 958449766 3:94259147-94259169 CCCCACCTGGGGCCCCTCCCTCA No data
Right 958449775 3:94259169-94259191 ATTGTTGCTAACTTATCATCAGG No data
958449768_958449775 -3 Left 958449768 3:94259149-94259171 CCACCTGGGGCCCCTCCCTCATT No data
Right 958449775 3:94259169-94259191 ATTGTTGCTAACTTATCATCAGG No data
958449767_958449775 -2 Left 958449767 3:94259148-94259170 CCCACCTGGGGCCCCTCCCTCAT No data
Right 958449775 3:94259169-94259191 ATTGTTGCTAACTTATCATCAGG No data
958449769_958449775 -6 Left 958449769 3:94259152-94259174 CCTGGGGCCCCTCCCTCATTGTT No data
Right 958449775 3:94259169-94259191 ATTGTTGCTAACTTATCATCAGG No data
958449765_958449775 0 Left 958449765 3:94259146-94259168 CCCCCACCTGGGGCCCCTCCCTC No data
Right 958449775 3:94259169-94259191 ATTGTTGCTAACTTATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958449775 Original CRISPR ATTGTTGCTAACTTATCATC AGG Intergenic
No off target data available for this crispr