ID: 958449778

View in Genome Browser
Species Human (GRCh38)
Location 3:94259190-94259212
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958449768_958449778 18 Left 958449768 3:94259149-94259171 CCACCTGGGGCCCCTCCCTCATT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449769_958449778 15 Left 958449769 3:94259152-94259174 CCTGGGGCCCCTCCCTCATTGTT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449772_958449778 6 Left 958449772 3:94259161-94259183 CCTCCCTCATTGTTGCTAACTTA No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449767_958449778 19 Left 958449767 3:94259148-94259170 CCCACCTGGGGCCCCTCCCTCAT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449770_958449778 8 Left 958449770 3:94259159-94259181 CCCCTCCCTCATTGTTGCTAACT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449766_958449778 20 Left 958449766 3:94259147-94259169 CCCCACCTGGGGCCCCTCCCTCA No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449771_958449778 7 Left 958449771 3:94259160-94259182 CCCTCCCTCATTGTTGCTAACTT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449773_958449778 3 Left 958449773 3:94259164-94259186 CCCTCATTGTTGCTAACTTATCA No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449765_958449778 21 Left 958449765 3:94259146-94259168 CCCCCACCTGGGGCCCCTCCCTC No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data
958449774_958449778 2 Left 958449774 3:94259165-94259187 CCTCATTGTTGCTAACTTATCAT No data
Right 958449778 3:94259190-94259212 GGACTCCACACTTTACAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr