ID: 958450033

View in Genome Browser
Species Human (GRCh38)
Location 3:94261137-94261159
Sequence TAATATCTCCATCTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958450028_958450033 19 Left 958450028 3:94261095-94261117 CCACAAGCAATATCCTAGTGAGG No data
Right 958450033 3:94261137-94261159 TAATATCTCCATCTTGTACAGGG No data
958450030_958450033 6 Left 958450030 3:94261108-94261130 CCTAGTGAGGTAAAGACAGCCTG No data
Right 958450033 3:94261137-94261159 TAATATCTCCATCTTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958450033 Original CRISPR TAATATCTCCATCTTGTACA GGG Intergenic
No off target data available for this crispr