ID: 958450766

View in Genome Browser
Species Human (GRCh38)
Location 3:94269625-94269647
Sequence TCAGTCCTTCCATGAAGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958450766_958450770 17 Left 958450766 3:94269625-94269647 CCGTGTCTTCATGGAAGGACTGA No data
Right 958450770 3:94269665-94269687 GTGTCCTGAGATTTCACCACTGG No data
958450766_958450767 -6 Left 958450766 3:94269625-94269647 CCGTGTCTTCATGGAAGGACTGA No data
Right 958450767 3:94269642-94269664 GACTGAATACCATCACTAGCAGG No data
958450766_958450768 -5 Left 958450766 3:94269625-94269647 CCGTGTCTTCATGGAAGGACTGA No data
Right 958450768 3:94269643-94269665 ACTGAATACCATCACTAGCAGGG No data
958450766_958450772 28 Left 958450766 3:94269625-94269647 CCGTGTCTTCATGGAAGGACTGA No data
Right 958450772 3:94269676-94269698 TTTCACCACTGGCTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958450766 Original CRISPR TCAGTCCTTCCATGAAGACA CGG (reversed) Intergenic
No off target data available for this crispr