ID: 958450767

View in Genome Browser
Species Human (GRCh38)
Location 3:94269642-94269664
Sequence GACTGAATACCATCACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958450766_958450767 -6 Left 958450766 3:94269625-94269647 CCGTGTCTTCATGGAAGGACTGA No data
Right 958450767 3:94269642-94269664 GACTGAATACCATCACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958450767 Original CRISPR GACTGAATACCATCACTAGC AGG Intergenic
No off target data available for this crispr