ID: 958451843

View in Genome Browser
Species Human (GRCh38)
Location 3:94282681-94282703
Sequence AAGGATGCCCTGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958451843_958451847 2 Left 958451843 3:94282681-94282703 CCTTCCTCTTTCAGGGCATCCTT No data
Right 958451847 3:94282706-94282728 AGTTTCTATGTTTAAGATGATGG No data
958451843_958451848 15 Left 958451843 3:94282681-94282703 CCTTCCTCTTTCAGGGCATCCTT No data
Right 958451848 3:94282719-94282741 AAGATGATGGCCACATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958451843 Original CRISPR AAGGATGCCCTGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr