ID: 958451843 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:94282681-94282703 |
| Sequence | AAGGATGCCCTGAAAGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958451843_958451847 | 2 | Left | 958451843 | 3:94282681-94282703 | CCTTCCTCTTTCAGGGCATCCTT | No data | ||
| Right | 958451847 | 3:94282706-94282728 | AGTTTCTATGTTTAAGATGATGG | No data | ||||
| 958451843_958451848 | 15 | Left | 958451843 | 3:94282681-94282703 | CCTTCCTCTTTCAGGGCATCCTT | No data | ||
| Right | 958451848 | 3:94282719-94282741 | AAGATGATGGCCACATAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958451843 | Original CRISPR | AAGGATGCCCTGAAAGAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||