ID: 958456326

View in Genome Browser
Species Human (GRCh38)
Location 3:94336291-94336313
Sequence AAGTTGTGAGAAATTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958456326_958456328 1 Left 958456326 3:94336291-94336313 CCTCACAGAATTTCTCACAACTT No data
Right 958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG No data
958456326_958456327 -10 Left 958456326 3:94336291-94336313 CCTCACAGAATTTCTCACAACTT No data
Right 958456327 3:94336304-94336326 CTCACAACTTACAGCAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958456326 Original CRISPR AAGTTGTGAGAAATTCTGTG AGG (reversed) Intergenic
No off target data available for this crispr