ID: 958456328

View in Genome Browser
Species Human (GRCh38)
Location 3:94336315-94336337
Sequence CAGCAGCAATGGAAAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958456326_958456328 1 Left 958456326 3:94336291-94336313 CCTCACAGAATTTCTCACAACTT No data
Right 958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958456328 Original CRISPR CAGCAGCAATGGAAAGCAGC TGG Intergenic
No off target data available for this crispr