ID: 958457051

View in Genome Browser
Species Human (GRCh38)
Location 3:94345318-94345340
Sequence CAGTGAACAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958457043_958457051 24 Left 958457043 3:94345271-94345293 CCCTGTCGGATCCGGAGCGGTGG No data
Right 958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG No data
958457046_958457051 13 Left 958457046 3:94345282-94345304 CCGGAGCGGTGGAAGTCAGCAGC No data
Right 958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG No data
958457045_958457051 23 Left 958457045 3:94345272-94345294 CCTGTCGGATCCGGAGCGGTGGA No data
Right 958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958457051 Original CRISPR CAGTGAACAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr