ID: 958468773

View in Genome Browser
Species Human (GRCh38)
Location 3:94492495-94492517
Sequence CCCCAAAAGCAGTGCCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958468769_958468773 -9 Left 958468769 3:94492481-94492503 CCACAGTCCAGATTCCCCAAAAG No data
Right 958468773 3:94492495-94492517 CCCCAAAAGCAGTGCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958468773 Original CRISPR CCCCAAAAGCAGTGCCTAGA GGG Intergenic
No off target data available for this crispr