ID: 958479651

View in Genome Browser
Species Human (GRCh38)
Location 3:94630502-94630524
Sequence CACTTGAACCAAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958479645_958479651 9 Left 958479645 3:94630470-94630492 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 958479651 3:94630502-94630524 CACTTGAACCAAGGAGACGGAGG No data
958479641_958479651 18 Left 958479641 3:94630461-94630483 CCCTGTAATCCCAGCTACTCAGG 0: 768
1: 2157
2: 3646
3: 3730
4: 3539
Right 958479651 3:94630502-94630524 CACTTGAACCAAGGAGACGGAGG No data
958479640_958479651 19 Left 958479640 3:94630460-94630482 CCCCTGTAATCCCAGCTACTCAG 0: 523
1: 1464
2: 2481
3: 2491
4: 2102
Right 958479651 3:94630502-94630524 CACTTGAACCAAGGAGACGGAGG No data
958479647_958479651 8 Left 958479647 3:94630471-94630493 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 958479651 3:94630502-94630524 CACTTGAACCAAGGAGACGGAGG No data
958479643_958479651 17 Left 958479643 3:94630462-94630484 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 958479651 3:94630502-94630524 CACTTGAACCAAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958479651 Original CRISPR CACTTGAACCAAGGAGACGG AGG Intergenic
No off target data available for this crispr