ID: 958489796

View in Genome Browser
Species Human (GRCh38)
Location 3:94757791-94757813
Sequence CAGCAGGCCTGGAGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958489792_958489796 11 Left 958489792 3:94757757-94757779 CCAGTTAGTCTCAATATGGCATG No data
Right 958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958489796 Original CRISPR CAGCAGGCCTGGAGAGAAGG TGG Intergenic
No off target data available for this crispr