ID: 958491460

View in Genome Browser
Species Human (GRCh38)
Location 3:94779469-94779491
Sequence GTGTAGCCACAAATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958491454_958491460 25 Left 958491454 3:94779421-94779443 CCTGTGGCATTGTGAAGCAATAA No data
Right 958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG No data
958491453_958491460 26 Left 958491453 3:94779420-94779442 CCCTGTGGCATTGTGAAGCAATA No data
Right 958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG No data
958491457_958491460 -7 Left 958491457 3:94779453-94779475 CCTTTGGAAGAGATAGGTGTAGC No data
Right 958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958491460 Original CRISPR GTGTAGCCACAAATGGAGGA TGG Intergenic
No off target data available for this crispr