ID: 958492821

View in Genome Browser
Species Human (GRCh38)
Location 3:94799211-94799233
Sequence TTTGAGAAGTTGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958492821_958492827 12 Left 958492821 3:94799211-94799233 CCCTCCTGCTTCAACTTCTCAAA No data
Right 958492827 3:94799246-94799268 CTGGCACATGCCACCATGACTGG No data
958492821_958492825 -7 Left 958492821 3:94799211-94799233 CCCTCCTGCTTCAACTTCTCAAA No data
Right 958492825 3:94799227-94799249 TCTCAAATAGCCAGGACTACTGG 0: 3
1: 50
2: 865
3: 9404
4: 73953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958492821 Original CRISPR TTTGAGAAGTTGAAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr