ID: 958495004

View in Genome Browser
Species Human (GRCh38)
Location 3:94833724-94833746
Sequence TATCCCAGCACCATTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958495004_958495006 10 Left 958495004 3:94833724-94833746 CCTATTCAAATGGTGCTGGGATA No data
Right 958495006 3:94833757-94833779 TATATGCTAAAGATTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958495004 Original CRISPR TATCCCAGCACCATTTGAAT AGG (reversed) Intergenic
No off target data available for this crispr