ID: 958501663

View in Genome Browser
Species Human (GRCh38)
Location 3:94918615-94918637
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958501663_958501666 2 Left 958501663 3:94918615-94918637 CCTACTAATATTTTTGAGCACCT No data
Right 958501666 3:94918640-94918662 CTGTATCCTATTGTAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958501663 Original CRISPR AGGTGCTCAAAAATATTAGT AGG (reversed) Intergenic
No off target data available for this crispr