ID: 958504438

View in Genome Browser
Species Human (GRCh38)
Location 3:94956231-94956253
Sequence GGAAGCAGCAAGTGTCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958504438_958504446 5 Left 958504438 3:94956231-94956253 CCTCGCTGACACTTGCTGCTTCC No data
Right 958504446 3:94956259-94956281 GGACAGGATATGTCCAAATGGGG No data
958504438_958504444 3 Left 958504438 3:94956231-94956253 CCTCGCTGACACTTGCTGCTTCC No data
Right 958504444 3:94956257-94956279 GGGGACAGGATATGTCCAAATGG No data
958504438_958504447 6 Left 958504438 3:94956231-94956253 CCTCGCTGACACTTGCTGCTTCC No data
Right 958504447 3:94956260-94956282 GACAGGATATGTCCAAATGGGGG No data
958504438_958504445 4 Left 958504438 3:94956231-94956253 CCTCGCTGACACTTGCTGCTTCC No data
Right 958504445 3:94956258-94956280 GGGACAGGATATGTCCAAATGGG No data
958504438_958504449 29 Left 958504438 3:94956231-94956253 CCTCGCTGACACTTGCTGCTTCC No data
Right 958504449 3:94956283-94956305 TAAACAGAAAGTACCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958504438 Original CRISPR GGAAGCAGCAAGTGTCAGCG AGG (reversed) Intergenic
No off target data available for this crispr