ID: 958508353

View in Genome Browser
Species Human (GRCh38)
Location 3:95012010-95012032
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958508348_958508353 19 Left 958508348 3:95011968-95011990 CCAATTAAAAACTGAGGCTCAAA No data
Right 958508353 3:95012010-95012032 CAGTCTGCATGGTAGTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr