ID: 958514991

View in Genome Browser
Species Human (GRCh38)
Location 3:95102768-95102790
Sequence ATTTTTAAGGTGCTTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958514984_958514991 22 Left 958514984 3:95102723-95102745 CCTCTCTATTAATGAACATTTTT No data
Right 958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958514991 Original CRISPR ATTTTTAAGGTGCTTGTTGA GGG Intergenic
No off target data available for this crispr