ID: 958515912

View in Genome Browser
Species Human (GRCh38)
Location 3:95115529-95115551
Sequence CTGTATACACATCTAAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958515908_958515912 6 Left 958515908 3:95115500-95115522 CCCAAATTATGACCAATCCTGTG No data
Right 958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG No data
958515909_958515912 5 Left 958515909 3:95115501-95115523 CCAAATTATGACCAATCCTGTGA No data
Right 958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG No data
958515910_958515912 -6 Left 958515910 3:95115512-95115534 CCAATCCTGTGAATGCTCTGTAT No data
Right 958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958515912 Original CRISPR CTGTATACACATCTAAAACA CGG Intergenic
No off target data available for this crispr