ID: 958517732

View in Genome Browser
Species Human (GRCh38)
Location 3:95140889-95140911
Sequence CTCCATGTTCTTTCATAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958517732_958517733 -4 Left 958517732 3:95140889-95140911 CCAAGCTATGAAAGAACATGGAG No data
Right 958517733 3:95140908-95140930 GGAGAAACTATAAATTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958517732 Original CRISPR CTCCATGTTCTTTCATAGCT TGG (reversed) Intergenic
No off target data available for this crispr