ID: 958521455

View in Genome Browser
Species Human (GRCh38)
Location 3:95193238-95193260
Sequence ATTTTAATTTGGGGCACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958521455_958521459 11 Left 958521455 3:95193238-95193260 CCTTTGGTGCCCCAAATTAAAAT No data
Right 958521459 3:95193272-95193294 TAATATCCTGTGAGCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958521455 Original CRISPR ATTTTAATTTGGGGCACCAA AGG (reversed) Intergenic
No off target data available for this crispr