ID: 958528650

View in Genome Browser
Species Human (GRCh38)
Location 3:95294414-95294436
Sequence ATCTAATCCTTTAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958528642_958528650 28 Left 958528642 3:95294363-95294385 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG No data
958528646_958528650 -3 Left 958528646 3:95294394-95294416 CCATGCCTGGTCCCAGTTTCATC No data
Right 958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG No data
958528645_958528650 0 Left 958528645 3:95294391-95294413 CCTCCATGCCTGGTCCCAGTTTC No data
Right 958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG No data
958528647_958528650 -8 Left 958528647 3:95294399-95294421 CCTGGTCCCAGTTTCATCTAATC No data
Right 958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG No data
958528643_958528650 27 Left 958528643 3:95294364-95294386 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958528650 Original CRISPR ATCTAATCCTTTAGAGAAGA AGG Intergenic
No off target data available for this crispr