ID: 958531410

View in Genome Browser
Species Human (GRCh38)
Location 3:95336633-95336655
Sequence CCCTATAAAGAGACTATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958531404_958531410 7 Left 958531404 3:95336603-95336625 CCTCTAGAGAAAATGAAGACAGT No data
Right 958531410 3:95336633-95336655 CCCTATAAAGAGACTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958531410 Original CRISPR CCCTATAAAGAGACTATGGA AGG Intergenic
No off target data available for this crispr