ID: 958532922

View in Genome Browser
Species Human (GRCh38)
Location 3:95357353-95357375
Sequence GCTGGTGATGATGAAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958532922_958532929 20 Left 958532922 3:95357353-95357375 CCAGGACTTTCATCATCACCAGC No data
Right 958532929 3:95357396-95357418 CCCCCTATGCTGCCGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958532922 Original CRISPR GCTGGTGATGATGAAAGTCC TGG (reversed) Intergenic
No off target data available for this crispr