ID: 958532924

View in Genome Browser
Species Human (GRCh38)
Location 3:95357371-95357393
Sequence GGAGGTCCTGTTATATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958532924_958532929 2 Left 958532924 3:95357371-95357393 CCAGCTAATATAACAGGACCTCC No data
Right 958532929 3:95357396-95357418 CCCCCTATGCTGCCGTTCACTGG No data
958532924_958532933 13 Left 958532924 3:95357371-95357393 CCAGCTAATATAACAGGACCTCC No data
Right 958532933 3:95357407-95357429 GCCGTTCACTGGAGATCACATGG No data
958532924_958532935 14 Left 958532924 3:95357371-95357393 CCAGCTAATATAACAGGACCTCC No data
Right 958532935 3:95357408-95357430 CCGTTCACTGGAGATCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958532924 Original CRISPR GGAGGTCCTGTTATATTAGC TGG (reversed) Intergenic
No off target data available for this crispr