ID: 958533388

View in Genome Browser
Species Human (GRCh38)
Location 3:95364737-95364759
Sequence GGTGAATTGCACCTCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958533388_958533395 8 Left 958533388 3:95364737-95364759 CCATCCCCGAGGTGCAATTCACC No data
Right 958533395 3:95364768-95364790 AAGAGAGGCAAGTTAATGCTGGG No data
958533388_958533392 -7 Left 958533388 3:95364737-95364759 CCATCCCCGAGGTGCAATTCACC No data
Right 958533392 3:95364753-95364775 ATTCACCATATTTTCAAGAGAGG No data
958533388_958533394 7 Left 958533388 3:95364737-95364759 CCATCCCCGAGGTGCAATTCACC No data
Right 958533394 3:95364767-95364789 CAAGAGAGGCAAGTTAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958533388 Original CRISPR GGTGAATTGCACCTCGGGGA TGG (reversed) Intergenic
No off target data available for this crispr