ID: 958533394

View in Genome Browser
Species Human (GRCh38)
Location 3:95364767-95364789
Sequence CAAGAGAGGCAAGTTAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958533389_958533394 3 Left 958533389 3:95364741-95364763 CCCCGAGGTGCAATTCACCATAT No data
Right 958533394 3:95364767-95364789 CAAGAGAGGCAAGTTAATGCTGG No data
958533390_958533394 2 Left 958533390 3:95364742-95364764 CCCGAGGTGCAATTCACCATATT No data
Right 958533394 3:95364767-95364789 CAAGAGAGGCAAGTTAATGCTGG No data
958533388_958533394 7 Left 958533388 3:95364737-95364759 CCATCCCCGAGGTGCAATTCACC No data
Right 958533394 3:95364767-95364789 CAAGAGAGGCAAGTTAATGCTGG No data
958533391_958533394 1 Left 958533391 3:95364743-95364765 CCGAGGTGCAATTCACCATATTT No data
Right 958533394 3:95364767-95364789 CAAGAGAGGCAAGTTAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958533394 Original CRISPR CAAGAGAGGCAAGTTAATGC TGG Intergenic
No off target data available for this crispr