ID: 958535976

View in Genome Browser
Species Human (GRCh38)
Location 3:95403934-95403956
Sequence GTTTTGAGATTTTGATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958535976_958535978 -3 Left 958535976 3:95403934-95403956 CCCAGAAATCAAAATCTCAAAAC No data
Right 958535978 3:95403954-95403976 AACCCTTGCTTCACTAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958535976 Original CRISPR GTTTTGAGATTTTGATTTCT GGG (reversed) Intergenic