ID: 958535977

View in Genome Browser
Species Human (GRCh38)
Location 3:95403935-95403957
Sequence GGTTTTGAGATTTTGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958535977_958535978 -4 Left 958535977 3:95403935-95403957 CCAGAAATCAAAATCTCAAAACC No data
Right 958535978 3:95403954-95403976 AACCCTTGCTTCACTAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958535977 Original CRISPR GGTTTTGAGATTTTGATTTC TGG (reversed) Intergenic