ID: 958535978 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:95403954-95403976 |
Sequence | AACCCTTGCTTCACTAATAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
958535976_958535978 | -3 | Left | 958535976 | 3:95403934-95403956 | CCCAGAAATCAAAATCTCAAAAC | No data | ||
Right | 958535978 | 3:95403954-95403976 | AACCCTTGCTTCACTAATATAGG | No data | ||||
958535975_958535978 | 3 | Left | 958535975 | 3:95403928-95403950 | CCTGTGCCCAGAAATCAAAATCT | No data | ||
Right | 958535978 | 3:95403954-95403976 | AACCCTTGCTTCACTAATATAGG | No data | ||||
958535977_958535978 | -4 | Left | 958535977 | 3:95403935-95403957 | CCAGAAATCAAAATCTCAAAACC | No data | ||
Right | 958535978 | 3:95403954-95403976 | AACCCTTGCTTCACTAATATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
958535978 | Original CRISPR | AACCCTTGCTTCACTAATAT AGG | Intergenic | ||