ID: 958537081

View in Genome Browser
Species Human (GRCh38)
Location 3:95418104-95418126
Sequence ACTACTATCTTAAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958537081_958537089 30 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537089 3:95418157-95418179 TGCATTCGGGGGAAAGGCTCAGG No data
958537081_958537083 -6 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537083 3:95418121-95418143 AGTAGTTTGGTTTAGTCGATTGG No data
958537081_958537088 24 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537088 3:95418151-95418173 TCTATATGCATTCGGGGGAAAGG No data
958537081_958537084 16 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537084 3:95418143-95418165 GCTTTATTTCTATATGCATTCGG No data
958537081_958537087 19 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537087 3:95418146-95418168 TTATTTCTATATGCATTCGGGGG No data
958537081_958537085 17 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537085 3:95418144-95418166 CTTTATTTCTATATGCATTCGGG No data
958537081_958537086 18 Left 958537081 3:95418104-95418126 CCTTCAGGGTTTAAGATAGTAGT No data
Right 958537086 3:95418145-95418167 TTTATTTCTATATGCATTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958537081 Original CRISPR ACTACTATCTTAAACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr