ID: 958537248

View in Genome Browser
Species Human (GRCh38)
Location 3:95419011-95419033
Sequence CAGAGAGAGGACAGGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958537248_958537255 24 Left 958537248 3:95419011-95419033 CCAGGGTCCCTGTCCTCTCTCTG No data
Right 958537255 3:95419058-95419080 AAAGTCTGTTCAGAGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958537248 Original CRISPR CAGAGAGAGGACAGGGACCC TGG (reversed) Intergenic
No off target data available for this crispr