ID: 958537653

View in Genome Browser
Species Human (GRCh38)
Location 3:95425067-95425089
Sequence CTGCAAAGCCACAGGTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958537653_958537662 19 Left 958537653 3:95425067-95425089 CCCATATACCTGTGGCTTTGCAG No data
Right 958537662 3:95425109-95425131 CCCTTCCCTGGCTGCTTTCATGG No data
958537653_958537664 23 Left 958537653 3:95425067-95425089 CCCATATACCTGTGGCTTTGCAG No data
Right 958537664 3:95425113-95425135 TCCCTGGCTGCTTTCATGGCTGG No data
958537653_958537657 7 Left 958537653 3:95425067-95425089 CCCATATACCTGTGGCTTTGCAG No data
Right 958537657 3:95425097-95425119 CTCCTCATCACCCCCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958537653 Original CRISPR CTGCAAAGCCACAGGTATAT GGG (reversed) Intergenic
No off target data available for this crispr