ID: 958551233

View in Genome Browser
Species Human (GRCh38)
Location 3:95616165-95616187
Sequence TAGCAGTCACAACATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958551230_958551233 11 Left 958551230 3:95616131-95616153 CCTTTGGCCATTTTCAATTTTAC No data
Right 958551233 3:95616165-95616187 TAGCAGTCACAACATGAGGAAGG No data
958551231_958551233 4 Left 958551231 3:95616138-95616160 CCATTTTCAATTTTACATAATTT No data
Right 958551233 3:95616165-95616187 TAGCAGTCACAACATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958551233 Original CRISPR TAGCAGTCACAACATGAGGA AGG Intergenic
No off target data available for this crispr