ID: 958552920

View in Genome Browser
Species Human (GRCh38)
Location 3:95639479-95639501
Sequence AACTTTTGCAAGCAGTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958552920_958552921 13 Left 958552920 3:95639479-95639501 CCATAATACTGCTTGCAAAAGTT No data
Right 958552921 3:95639515-95639537 ACTTTCAACTTCCAAAACACAGG No data
958552920_958552923 27 Left 958552920 3:95639479-95639501 CCATAATACTGCTTGCAAAAGTT No data
Right 958552923 3:95639529-95639551 AAACACAGGAGTTCATTTAGTGG No data
958552920_958552924 28 Left 958552920 3:95639479-95639501 CCATAATACTGCTTGCAAAAGTT No data
Right 958552924 3:95639530-95639552 AACACAGGAGTTCATTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958552920 Original CRISPR AACTTTTGCAAGCAGTATTA TGG (reversed) Intergenic
No off target data available for this crispr