ID: 958552921

View in Genome Browser
Species Human (GRCh38)
Location 3:95639515-95639537
Sequence ACTTTCAACTTCCAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958552920_958552921 13 Left 958552920 3:95639479-95639501 CCATAATACTGCTTGCAAAAGTT No data
Right 958552921 3:95639515-95639537 ACTTTCAACTTCCAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958552921 Original CRISPR ACTTTCAACTTCCAAAACAC AGG Intergenic
No off target data available for this crispr