ID: 958557814

View in Genome Browser
Species Human (GRCh38)
Location 3:95703098-95703120
Sequence TGACCTTAATCTCATGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958557809_958557814 27 Left 958557809 3:95703048-95703070 CCTGGTTTTGGCATACTCTCATT No data
Right 958557814 3:95703098-95703120 TGACCTTAATCTCATGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958557814 Original CRISPR TGACCTTAATCTCATGTTGA AGG Intergenic