ID: 958560061

View in Genome Browser
Species Human (GRCh38)
Location 3:95736816-95736838
Sequence TCAACTCCGAGGAGCCTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958560057_958560061 15 Left 958560057 3:95736778-95736800 CCTTCGAGGAGAAGGTATTACTT No data
Right 958560061 3:95736816-95736838 TCAACTCCGAGGAGCCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958560061 Original CRISPR TCAACTCCGAGGAGCCTCGT TGG Intergenic
No off target data available for this crispr