ID: 958562175

View in Genome Browser
Species Human (GRCh38)
Location 3:95760191-95760213
Sequence CTGCAGCCTGCTTTTCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958562167_958562175 22 Left 958562167 3:95760146-95760168 CCCACTGGCTTCCAGGAGCACAC No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562170_958562175 11 Left 958562170 3:95760157-95760179 CCAGGAGCACACAGCCCTGGCTG No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562171_958562175 -3 Left 958562171 3:95760171-95760193 CCCTGGCTGTGCCTTTCCTGCTG No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562163_958562175 30 Left 958562163 3:95760138-95760160 CCCCAGCTCCCACTGGCTTCCAG No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562164_958562175 29 Left 958562164 3:95760139-95760161 CCCAGCTCCCACTGGCTTCCAGG No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562166_958562175 28 Left 958562166 3:95760140-95760162 CCAGCTCCCACTGGCTTCCAGGA No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562168_958562175 21 Left 958562168 3:95760147-95760169 CCACTGGCTTCCAGGAGCACACA No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data
958562172_958562175 -4 Left 958562172 3:95760172-95760194 CCTGGCTGTGCCTTTCCTGCTGC No data
Right 958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958562175 Original CRISPR CTGCAGCCTGCTTTTCTTTG TGG Intergenic
No off target data available for this crispr