ID: 958578536

View in Genome Browser
Species Human (GRCh38)
Location 3:95985853-95985875
Sequence GACTGTGTTCCCGGTGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958578533_958578536 20 Left 958578533 3:95985810-95985832 CCTAGAAATCCTTTTGTGTAAAT No data
Right 958578536 3:95985853-95985875 GACTGTGTTCCCGGTGTCTTAGG No data
958578534_958578536 11 Left 958578534 3:95985819-95985841 CCTTTTGTGTAAATAAAAACAGA No data
Right 958578536 3:95985853-95985875 GACTGTGTTCCCGGTGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958578536 Original CRISPR GACTGTGTTCCCGGTGTCTT AGG Intergenic
No off target data available for this crispr