ID: 958586281

View in Genome Browser
Species Human (GRCh38)
Location 3:96091687-96091709
Sequence CTATCTATAAGCCCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958586281_958586289 14 Left 958586281 3:96091687-96091709 CCCAGTCAGGGGCTTATAGATAG No data
Right 958586289 3:96091724-96091746 CTGAGAGAAGGGGCAGCTGTGGG No data
958586281_958586284 3 Left 958586281 3:96091687-96091709 CCCAGTCAGGGGCTTATAGATAG No data
Right 958586284 3:96091713-96091735 TCCGAGAGCACCTGAGAGAAGGG No data
958586281_958586288 13 Left 958586281 3:96091687-96091709 CCCAGTCAGGGGCTTATAGATAG No data
Right 958586288 3:96091723-96091745 CCTGAGAGAAGGGGCAGCTGTGG No data
958586281_958586290 19 Left 958586281 3:96091687-96091709 CCCAGTCAGGGGCTTATAGATAG No data
Right 958586290 3:96091729-96091751 AGAAGGGGCAGCTGTGGGCACGG No data
958586281_958586286 4 Left 958586281 3:96091687-96091709 CCCAGTCAGGGGCTTATAGATAG No data
Right 958586286 3:96091714-96091736 CCGAGAGCACCTGAGAGAAGGGG No data
958586281_958586283 2 Left 958586281 3:96091687-96091709 CCCAGTCAGGGGCTTATAGATAG No data
Right 958586283 3:96091712-96091734 CTCCGAGAGCACCTGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958586281 Original CRISPR CTATCTATAAGCCCCTGACT GGG (reversed) Intergenic