ID: 958588152

View in Genome Browser
Species Human (GRCh38)
Location 3:96118018-96118040
Sequence TACCCTCTGAAGCAACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958588152_958588157 8 Left 958588152 3:96118018-96118040 CCAGGCAGTTGCTTCAGAGGGTA No data
Right 958588157 3:96118049-96118071 AAGCCTTGGCAACTTCCACATGG 0: 30
1: 480
2: 882
3: 1397
4: 1542
958588152_958588161 23 Left 958588152 3:96118018-96118040 CCAGGCAGTTGCTTCAGAGGGTA No data
Right 958588161 3:96118064-96118086 CCACATGGTGTTGAGCCTGTGGG 0: 122
1: 378
2: 850
3: 1226
4: 1376
958588152_958588159 22 Left 958588152 3:96118018-96118040 CCAGGCAGTTGCTTCAGAGGGTA No data
Right 958588159 3:96118063-96118085 TCCACATGGTGTTGAGCCTGTGG 0: 146
1: 319
2: 652
3: 746
4: 742
958588152_958588153 -6 Left 958588152 3:96118018-96118040 CCAGGCAGTTGCTTCAGAGGGTA No data
Right 958588153 3:96118035-96118057 AGGGTAGAAGCCCCAAGCCTTGG 0: 12
1: 343
2: 1211
3: 1767
4: 1687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958588152 Original CRISPR TACCCTCTGAAGCAACTGCC TGG (reversed) Intergenic
No off target data available for this crispr