ID: 958592115

View in Genome Browser
Species Human (GRCh38)
Location 3:96171229-96171251
Sequence TTGATAGGGCTCCATAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958592110_958592115 -3 Left 958592110 3:96171209-96171231 CCCTTCACAGTACTCTGGGGTTG No data
Right 958592115 3:96171229-96171251 TTGATAGGGCTCCATAGCTTGGG No data
958592111_958592115 -4 Left 958592111 3:96171210-96171232 CCTTCACAGTACTCTGGGGTTGA No data
Right 958592115 3:96171229-96171251 TTGATAGGGCTCCATAGCTTGGG No data
958592108_958592115 -1 Left 958592108 3:96171207-96171229 CCCCCTTCACAGTACTCTGGGGT No data
Right 958592115 3:96171229-96171251 TTGATAGGGCTCCATAGCTTGGG No data
958592109_958592115 -2 Left 958592109 3:96171208-96171230 CCCCTTCACAGTACTCTGGGGTT No data
Right 958592115 3:96171229-96171251 TTGATAGGGCTCCATAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958592115 Original CRISPR TTGATAGGGCTCCATAGCTT GGG Intergenic