ID: 958593365

View in Genome Browser
Species Human (GRCh38)
Location 3:96189670-96189692
Sequence TGAAGTAGCTGCCTTGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958593362_958593365 8 Left 958593362 3:96189639-96189661 CCTTCTCTGTAGAACCTATAGGA No data
Right 958593365 3:96189670-96189692 TGAAGTAGCTGCCTTGCAAGTGG No data
958593363_958593365 -6 Left 958593363 3:96189653-96189675 CCTATAGGAGCCTACGTTGAAGT No data
Right 958593365 3:96189670-96189692 TGAAGTAGCTGCCTTGCAAGTGG No data
958593359_958593365 10 Left 958593359 3:96189637-96189659 CCCCTTCTCTGTAGAACCTATAG No data
Right 958593365 3:96189670-96189692 TGAAGTAGCTGCCTTGCAAGTGG No data
958593360_958593365 9 Left 958593360 3:96189638-96189660 CCCTTCTCTGTAGAACCTATAGG No data
Right 958593365 3:96189670-96189692 TGAAGTAGCTGCCTTGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958593365 Original CRISPR TGAAGTAGCTGCCTTGCAAG TGG Intergenic
No off target data available for this crispr