ID: 958594196

View in Genome Browser
Species Human (GRCh38)
Location 3:96201071-96201093
Sequence CTGTGCTTGTTGAGGTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958594196_958594199 -10 Left 958594196 3:96201071-96201093 CCATTACACCTCAACAAGCACAG No data
Right 958594199 3:96201084-96201106 ACAAGCACAGTCCACTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958594196 Original CRISPR CTGTGCTTGTTGAGGTGTAA TGG (reversed) Intergenic
No off target data available for this crispr