ID: 958594602

View in Genome Browser
Species Human (GRCh38)
Location 3:96205361-96205383
Sequence GTCAAAAATAAGATGACTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958594602_958594603 3 Left 958594602 3:96205361-96205383 CCTATAGTCATCTTATTTTTGAC No data
Right 958594603 3:96205387-96205409 GCCAATAATCACAAGCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958594602 Original CRISPR GTCAAAAATAAGATGACTAT AGG (reversed) Intergenic
No off target data available for this crispr