ID: 958600355

View in Genome Browser
Species Human (GRCh38)
Location 3:96289028-96289050
Sequence TCACATGCAGAATCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958600353_958600355 7 Left 958600353 3:96288998-96289020 CCAGACAGAAGTTCGCTTCAGGA No data
Right 958600355 3:96289028-96289050 TCACATGCAGAATCTCTGCTAGG No data
958600351_958600355 8 Left 958600351 3:96288997-96289019 CCCAGACAGAAGTTCGCTTCAGG No data
Right 958600355 3:96289028-96289050 TCACATGCAGAATCTCTGCTAGG No data
958600350_958600355 16 Left 958600350 3:96288989-96289011 CCTGAATGCCCAGACAGAAGTTC No data
Right 958600355 3:96289028-96289050 TCACATGCAGAATCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958600355 Original CRISPR TCACATGCAGAATCTCTGCT AGG Intergenic
No off target data available for this crispr